Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 501124
End position: 501150
Length: 27

DNA sequence
>NC_008576, from 501124 to 501150 (27 bp); Magnetococcus sp. MC-1 GGTGGTGCGGGTGGTGCGGGTGGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 500425-504396	Sequence	Mmc1_0421 - cadherin (Protein is coded in complementary strand; from 504396 to 500425)