Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 4528249
End position: 4528302
Length: 54

DNA sequence
>NC_008576, from 4528249 to 4528302 (54 bp); Magnetococcus sp. MC-1 TCTTCGGCTTCGGGCTCTTCTTCGGCTTCGGGCTCTTCTTCGGCTTCGGGCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4526656-4530390	Sequence	Mmc1_3605 - Zinc finger-domain-containing protein (Protein is coded in complementary strand; from 4530390 to 4526656)