Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 4511267
End position: 4511311
Length: 45

DNA sequence
>NC_008576, from 4511267 to 4511311 (45 bp); Magnetococcus sp. MC-1 GCGGTACGGGCCTGTTCGGCGCGGGCCTGTTCGGTACGGGCTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4510553-4512253	Sequence	Mmc1_3592 - hypothetical protein (Protein is coded in complementary strand; from 4512253 to 4510553)