Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 4448979
End position: 4449032
Length: 54

DNA sequence
>NC_008576, from 4448979 to 4449032 (54 bp); Magnetococcus sp. MC-1 TGACCCATACCTTTACCTTGGCCCATACCCATACCTTGGCCCATACCCATACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4448790-4449419	Sequence	Mmc1_3545 - signal transduction protein (Protein is coded in complementary strand; from 4449419 to 4448790)