Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 434009
End position: 434032
Length: 24

DNA sequence
>NC_008576, from 434009 to 434032 (24 bp); Magnetococcus sp. MC-1 GGTCAGGGGCAGGGTTAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 431469-434363	Sequence	Mmc1_0375 - ABC transporter inner membrane protein (Protein is coded in complementary strand; from 434363 to 431469)