Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 4172623
End position: 4172652
Length: 30

DNA sequence
>NC_008576, from 4172623 to 4172652 (30 bp); Magnetococcus sp. MC-1 TCATCATCATCGTCGTCATCATCGTCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4172593-4173756	Sequence	Mmc1_3350 - GTP1/OBG domain-containing protein (Protein is coded in complementary strand; from 4173756 to 4172593)