Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 4168354
End position: 4168380
Length: 27

DNA sequence
>NC_008576, from 4168354 to 4168380 (27 bp); Magnetococcus sp. MC-1 TCGTCGTCTTCATCGTCTTCATCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4168321-4169001	Sequence	Mmc1_3346 - iojap family protein (Protein is coded in complementary strand; from 4169001 to 4168321)