Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 3803922
End position: 3803951
Length: 30

DNA sequence
>NC_008576, from 3803922 to 3803951 (30 bp); Magnetococcus sp. MC-1 CCTCGGCCTCGGCTTCGGCCTCGGCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3802883-3805009	Sequence	Mmc1_3040 - flagellar biosynthesis protein FlhA (Protein is coded in complementary strand; from 3805009 to 3802883)