Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 3494791
End position: 3494826
Length: 36

DNA sequence
>NC_008576, from 3494791 to 3494826 (36 bp); Magnetococcus sp. MC-1 CACCCTCTTGACGGCCCTCTTGACGGCCCTCTTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3494640-3495584	Sequence	Mmc1_2781 - hypothetical protein (Protein is coded in complementary strand; from 3495584 to 3494640)