Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 343388
End position: 343411
Length: 24

DNA sequence
>NC_008576, from 343388 to 343411 (24 bp); Magnetococcus sp. MC-1 CCCCACCCGCACCGCCACCCTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 340981-343680	Sequence	Mmc1_0298 - periplasmic sensor hybrid histidine kinase (Protein is coded in complementary strand; from 343680 to 340981)