Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 336290
End position: 336325
Length: 36

DNA sequence
>NC_008576, from 336290 to 336325 (36 bp); Magnetococcus sp. MC-1 CATGCCGCCCATACCGCCCATGCCGCCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 336285-337940	Sequence	Mmc1_0295 - chaperonin GroEL (Protein is coded in complementary strand; from 337940 to 336285)