Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 3253373
End position: 3253408
Length: 36

DNA sequence
>NC_008576, from 3253373 to 3253408 (36 bp); Magnetococcus sp. MC-1 CCCTCTTGACGGCCCTCTTGACGGCCCTCTTGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3253220-3254164	Sequence	Mmc1_2547 - hypothetical protein (Protein is coded in complementary strand; from 3254164 to 3253220)