Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 3224284
End position: 3224313
Length: 30

DNA sequence
>NC_008576, from 3224284 to 3224313 (30 bp); Magnetococcus sp. MC-1 CCACGCAACCCTACACAACCACATGCAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3224261-3224635	Sequence	Mmc1_2534 - hypothetical protein (Protein is coded in complementary strand; from 3224635 to 3224261)