Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 3069291
End position: 3069326
Length: 36

DNA sequence
>NC_008576, from 3069291 to 3069326 (36 bp); Magnetococcus sp. MC-1 AACCATAGCCGTAGCCATAACCGTAACCATAACCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3069242-3071860	Sequence	Mmc1_2405 - lipopolysaccharide biosynthesis protein (Protein is coded in complementary strand; from 3071860 to 3069242)