Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2932906
End position: 2932953
Length: 48

DNA sequence
>NC_008576, from 2932906 to 2932953 (48 bp); Magnetococcus sp. MC-1 CCTCCAACAAAACACCCCGGCAACAAAACACCCTGGCAACAAAACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2932901-2933209	Sequence	Mmc1_2301 - hypothetical protein (Protein is coded in complementary strand; from 2933209 to 2932901)