Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2907089
End position: 2907142
Length: 54

DNA sequence
>NC_008576, from 2907089 to 2907142 (54 bp); Magnetococcus sp. MC-1 CTTTGGCTGTTTTGGCCGCTTTGGCTGTTTTGGCCGCTTTGGCTGTTTTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2906800-2907384	Sequence	Mmc1_2275 - cell wall protein TIR3 (Protein is coded in complementary strand; from 2907384 to 2906800)