Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2688483
End position: 2688527
Length: 45

DNA sequence
>NC_008576, from 2688483 to 2688527 (45 bp); Magnetococcus sp. MC-1 ACCCGTGCCGCCCGTAGCGGTGCCACCCGTAGCGGTGCCACCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2687182-2731932	Sequence	Mmc1_2179 - outer membrane adhesin-like protein (Protein is coded in complementary strand; from 2731932 to 2687182)