Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2324274
End position: 2324297
Length: 24

DNA sequence
>NC_008576, from 2324274 to 2324297 (24 bp); Magnetococcus sp. MC-1 ACGGCGACGGCGGCGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2324068-2325630	Sequence	Mmc1_1868 - PSP1 domain-containing protein (Protein is coded in complementary strand; from 2325630 to 2324068)