Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2301796
End position: 2301820
Length: 25

DNA sequence
>NC_008576, from 2301796 to 2301820 (25 bp); Magnetococcus sp. MC-1 TTTTTTATTTTTTTCTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2301440-2303500	Sequence	Mmc1_1856 - methionyl-tRNA synthetase (Protein is coded in complementary strand; from 2303500 to 2301440)