Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2195074
End position: 2195097
Length: 24

DNA sequence
>NC_008576, from 2195074 to 2195097 (24 bp); Magnetococcus sp. MC-1 CGACGGCGGCGGCGACGACGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2194201-2197155	Sequence	Mmc1_1776 - ribonuclease E (Protein is coded in complementary strand; from 2197155 to 2194201)