Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2003074
End position: 2003097
Length: 24

DNA sequence
>NC_008576, from 2003074 to 2003097 (24 bp); Magnetococcus sp. MC-1 CCACCACCATCACCACCACCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2002818-2004497	Sequence	Mmc1_1616 - beta-lactamase domain-containing protein (Protein is coded in complementary strand; from 2004497 to 2002818)