Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 2001416
End position: 2001442
Length: 27

DNA sequence
>NC_008576, from 2001416 to 2001442 (27 bp); Magnetococcus sp. MC-1 ATCCTCCAGTTCCTCCAGTTCCTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1998381-2002814	Sequence	Mmc1_1615 - DNA translocase FtsK (Protein is coded in complementary strand; from 2002814 to 1998381)