Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 1398571
End position: 1398594
Length: 24

DNA sequence
>NC_008576, from 1398571 to 1398594 (24 bp); Magnetococcus sp. MC-1 GGTGGCGGTGGCGGTGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1398565-1399533	Sequence	Mmc1_1113 - hypothetical protein (Protein is coded in complementary strand; from 1399533 to 1398565)