Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 1281035
End position: 1281082
Length: 48

DNA sequence
>NC_008576, from 1281035 to 1281082 (48 bp); Magnetococcus sp. MC-1 TCTTGACGTCCCTCTTGACGTCCCTCTTGACGTCCCTCTTGACGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1280843-1281874	Sequence	Mmc1_1045 - transposase (Protein is coded in complementary strand; from 1281874 to 1280843)