Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 2301564
End position: 2301617
Length: 54

DNA sequence
>NC_008390, from 2301564 to 2301617 (54 bp); Burkholderia cepacia AMMD chromosome 1 GCCGGCGCATAAACGGGCGCCGGTGCATACACAGGCGCCGGTGCATACACGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2301411-2301791	Sequence	Bamb_2095 - hypothetical protein (Protein is coded in complementary strand; from 2301791 to 2301411)