Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1248935
End position: 1248979
Length: 45

DNA sequence
>NC_008390, from 1248935 to 1248979 (45 bp); Burkholderia cepacia AMMD chromosome 1 GCCGACGTCGAAGCGGCCGATGTCGAAGCGGCCGGCGTCGAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1248746-1249924	Sequence	Bamb_1137 - hypothetical protein (Protein is coded in complementary strand; from 1249924 to 1248746)