Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1754182
End position: 1754220
Length: 39

DNA sequence
>NC_008390, from 1754182 to 1754220 (39 bp); Burkholderia cepacia AMMD chromosome 1 GACCCATGCAACTGACGAATGCAACTCACCCATGCAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1751322-1754189	Sequence	Bamb_1583 - ATP-dependent transcription regulator LuxR (Protein is coded in complementary strand; from 1754189 to 1751322)