Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 637442
End position: 637477
Length: 36

DNA sequence
>NC_008390, from 637442 to 637477 (36 bp); Burkholderia cepacia AMMD chromosome 1 GCCGTTGCCGTTGCCATTGGCGTTCCCGTTCCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 636465-641777	Sequence	Bamb_0568 - outer membrane autotransporter (Protein is coded in complementary strand; from 641777 to 636465)