Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 497283
End position: 497318
Length: 36

DNA sequence
>NC_008390, from 497283 to 497318 (36 bp); Burkholderia cepacia AMMD chromosome 1 GCGCTGCAGGTCGCGCTCGAGGTCGAGCTGCTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 497203-497994	Sequence	Bamb_0446 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 497994 to 497203)