Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 2341246
End position: 2341281
Length: 36

DNA sequence
>NC_008390, from 2341246 to 2341281 (36 bp); Burkholderia cepacia AMMD chromosome 1 TCGGCTGCTGCTTCGTCGGCTGCTTCGGCAGTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2341236-2341418	Sequence	Bamb_2129 - hypothetical protein (Protein is coded in complementary strand; from 2341418 to 2341236)