Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 877417
End position: 877449
Length: 33

DNA sequence
>NC_008390, from 877417 to 877449 (33 bp); Burkholderia cepacia AMMD chromosome 1 GGTCGGTAACTCGGCGGTAACTCGCCGGTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 877450-877773	Sequence	Bamb_0788 - rhodanese domain-containing protein (Protein is coded in complementary strand; from 877773 to 877450)