Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 2779852
End position: 2779884
Length: 33

DNA sequence
>NC_008390, from 2779852 to 2779884 (33 bp); Burkholderia cepacia AMMD chromosome 1 CGGCGGCGGCGCGGCGGCGGAACAGCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2779818-2780372	Sequence	Bamb_2523 - hypothetical protein (Protein is coded in complementary strand; from 2780372 to 2779818)