Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 2771654
End position: 2771680
Length: 27

DNA sequence
>NC_008390, from 2771654 to 2771680 (27 bp); Burkholderia cepacia AMMD chromosome 1 CGATGTTCGCGATGTCCGCGAAGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2771476-2772987	Sequence	Bamb_2515 - leucyl aminopeptidase (Protein is coded in complementary strand; from 2772987 to 2771476)