Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 2434644
End position: 2434670
Length: 27

DNA sequence
>NC_008390, from 2434644 to 2434670 (27 bp); Burkholderia cepacia AMMD chromosome 1 GCCGCCCATGCCGCCCAGGCCGCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2433511-2435199	Sequence	Bamb_2209 - urocanate hydratase (Protein is coded in complementary strand; from 2435199 to 2433511)