Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 201145
End position: 201171
Length: 27

DNA sequence
>NC_008390, from 201145 to 201171 (27 bp); Burkholderia cepacia AMMD chromosome 1 CCGCGCCGGCCGCACCGGCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 200386-202620	Sequence	Bamb_0169 - CheA signal transduction histidine kinase