Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1873948
End position: 1873974
Length: 27

DNA sequence
>NC_008390, from 1873948 to 1873974 (27 bp); Burkholderia cepacia AMMD chromosome 1 TTGTCCGGCTTGGCCGGCTTGGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1871920-1874118	Sequence	Bamb_1691 - TonB-dependent receptor, plug (Protein is coded in complementary strand; from 1874118 to 1871920)