Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1577488
End position: 1577514
Length: 27

DNA sequence
>NC_008390, from 1577488 to 1577514 (27 bp); Burkholderia cepacia AMMD chromosome 1 CCACCGTTACCACCGTTACCACCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1577239-1580157	Sequence	Bamb_1428 - chitinase (Protein is coded in complementary strand; from 1580157 to 1577239)