Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1179415
End position: 1179441
Length: 27

DNA sequence
>NC_008390, from 1179415 to 1179441 (27 bp); Burkholderia cepacia AMMD chromosome 1 CCCGAAGCACCCGATGCACCCGATGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1179340-1180731	Sequence	Bamb_1080 - RND family efflux transporter MFP subunit (Protein is coded in complementary strand; from 1180731 to 1179340)