Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1041953
End position: 1041979
Length: 27

DNA sequence
>NC_008390, from 1041953 to 1041979 (27 bp); Burkholderia cepacia AMMD chromosome 1 CGGTCAATCCGGTGAATCCGGTCAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1041975-1042292	Sequence	Bamb_0951 - hypothetical protein (Protein is coded in complementary strand; from 1042292 to 1041975)