Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 3545338
End position: 3545362
Length: 25

DNA sequence
>NC_008390, from 3545338 to 3545362 (25 bp); Burkholderia cepacia AMMD chromosome 1 CGCGCAGCGCGGCGCCGCGCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3544662-3545804	Sequence	Bamb_3205 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 3545804 to 3544662)