Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 36274
End position: 36297
Length: 24

DNA sequence
>NC_008390, from 36274 to 36297 (24 bp); Burkholderia cepacia AMMD chromosome 1 ACGAGCACGATCGCGAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 35437-36804	Sequence	Bamb_0023 - periplasmic sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 36804 to 35437)