Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 3248633
End position: 3248656
Length: 24

DNA sequence
>NC_008390, from 3248633 to 3248656 (24 bp); Burkholderia cepacia AMMD chromosome 1 CTCAGCGCATCAGCGCCGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3248643-3249794	Sequence	Bamb_2946 - VirB8 protein (Protein is coded in complementary strand; from 3249794 to 3248643)