Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 2710041
End position: 2710064
Length: 24

DNA sequence
>NC_008390, from 2710041 to 2710064 (24 bp); Burkholderia cepacia AMMD chromosome 1 CGCGCGCGAGCGCGTGCGCGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2709383-2710417	Sequence	Bamb_2460 - AraC family transcriptional regulator