Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1950413
End position: 1950436
Length: 24

DNA sequence
>NC_008390, from 1950413 to 1950436 (24 bp); Burkholderia cepacia AMMD chromosome 1 CCCGACCTCGACCGCGACCTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1950222-1952696	Sequence	Bamb_1765 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 1952696 to 1950222)