Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1907040
End position: 1907063
Length: 24

DNA sequence
>NC_008390, from 1907040 to 1907063 (24 bp); Burkholderia cepacia AMMD chromosome 1 TTCTGCATCTGCTCCTGCATCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1906971-1907537	Sequence	Bamb_1726 - polyhydroxyalkonate synthesis repressor PhaR (Protein is coded in complementary strand; from 1907537 to 1906971)