Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 188670
End position: 188693
Length: 24

DNA sequence
>NC_008390, from 188670 to 188693 (24 bp); Burkholderia cepacia AMMD chromosome 1 GGTCGTGCTCGTGCTCGTGCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 187276-188703	Sequence	Bamb_0155 - flagellar hook-associated 2 domain-containing protein (Protein is coded in complementary strand; from 188703 to 187276)