Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1609715
End position: 1609738
Length: 24

DNA sequence
>NC_008390, from 1609715 to 1609738 (24 bp); Burkholderia cepacia AMMD chromosome 1 CCGATTCCGCTTCCGTTTCCGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1609703-1610866	Sequence	Bamb_1461 - 3-hydroxyisobutyryl-CoA hydrolase