Sequence retrieval

Genome: Burkholderia cepacia AMMD chromosome 1
Start position: 1365661
End position: 1365684
Length: 24

DNA sequence
>NC_008390, from 1365661 to 1365684 (24 bp); Burkholderia cepacia AMMD chromosome 1 CGCGATCACGATCGCGAGCGAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1365500-1366429	Sequence	Bamb_1250 - phosphatidate cytidylyltransferase (Protein is coded in complementary strand; from 1366429 to 1365500)