Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1855853
End position: 1855915
Length: 63

DNA sequence
>NC_008261, from 1855853 to 1855915 (63 bp); Clostridium perfringens ATCC 13124 ACCACAGTTATTTCCGAATCCTCCGCAGTTATTTCCAAAGCCACCACAATTGTTTCCAAATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1855590-1856072	Sequence	CPF_1642 - hypothetical protein (Protein is coded in complementary strand; from 1856072 to 1855590)