Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1411673
End position: 1411726
Length: 54

DNA sequence
>NC_008261, from 1411673 to 1411726 (54 bp); Clostridium perfringens ATCC 13124 TCCTCCACCACCGCCGCCACCGCCACCACCGCCACCTCCGCCACCACCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1411035-1411805	Sequence	CPF_1240 - hypothetical protein (Protein is coded in complementary strand; from 1411805 to 1411035)